Seasonal Dynamics of the Genetic Diversity of Mycobacteria in the Waters of Some Lowlands in Buruli Ulcer Endemic Areas in Côte d’Ivoire

The aim of this study was to assess the seasonal dynamics of mycobacterial genes from aquatic ecosystems. To achieve this goal, two field trips were conducted in four towns endemic to Buruli ulcer in Côte d’Ivoire: Abidjan, Daloa, Tiassalé, and Yamoussoukro; one during the dry season and the other during the rainy season. Water was analyzed for the presence of the insertion sequence IS2404 using real-time PCR. Conventional PCR was then used to highlight MIRU/VNTR sequences. Following the analyses, six samples presented the MIRU 1 sequence during the dry season, with one copy found in three samples and two copies in another three. In contrast, during the rainy season, seven samples contained the MIRU 1 sequence, with two copies in one sample and three copies in two others. It is important to note that all samples were negative for the Locus 6 gene. This study highlights the significant impact of seasonal climatic conditions on the genetic composition of water samples and suggests a close correlation between genetic markers and mycobacterial contamination. These findings could have important public health and water resource management implications, as they provide additional information to understanding the risks associated with water contamination based on seasons. This seasonal approach to studying genetic markers in water samples opens new avenues for further research aimed at deepening our understanding of the dynamics of microbiological contaminants caused by mycobacteria in aquatic ecosystems.

Introduction

Water quality is a critical element for human health and the balance of ecosystems, as indicated by the World Health Organization (WHO, 2003). However, microbiological contamination of water represents a global challenge, with the risk of serious or even fatal waterborne diseases, as highlighted by Tulchinsky (2018). Therefore, understanding the genetic diversity of contaminants present in water is fundamental to assessing the risks associated with its consumption or use (Allix-Béguecet al., 2014). Moreover, seasonal conditions significantly influence water quality and the presence of contaminants (Adjemianet al., 2012; Bojarczuket al., 2018).

In the aforementioned context, it is crucial to emphasize that while M. ulcerans is generally recognized as the etiological agent responsible for ulcerations, some studies have revealed the presence of other mycobacteria involved in skin infections (Cox, 1981; Frisket al., 2003; George, 2023; Ichikiet al., 1997). This discovery highlights the imperative to understand the genetic diversity of mycobacteria present in the aquatic environment, given that they could potentially represent a risk to human health. To effectively characterize this genetic diversity, specific markers such as the IS2404 sequences and MIRU VNTRs play a central role (Vakouet al., 2016). These genetic markers allow for the differentiation of mycobacterial strains and provide a better understanding of their distribution in the aquatic environment. Additionally, studies conducted in Côte d’Ivoire have also highlighted the genetic diversity of mycobacteria, both in environmental and clinical samples (Tchanet al., 2023; Zeukenget al., 2021).

Materials and Methods

Sampling Stations and their Geographic Location

Study Location and Duration: Sampling was conducted in various localities across Côte d’Ivoire, covering different geographic regions. The Adiopodoumé site included the village of Adopodoumé, located southwest of the city of Abidjan, where five sampling points were selected. The first sample was taken from Lake Évêché (5.36615, −4.00826), while the second was taken from the lake in Province 1 (5.36095, −4.00826). The third sample was collected from the Gbokora 1 station (6.90117, −6.45093), followed by the fourth station at Gbokora 2 lake (6.89917, −6.45093). Finally, the last sampling station was located on the lake in the Commerce neighborhood (5.35995, −4.00826). In the third city, Tiassalé, samples were also taken from five different points. The first sample was collected from Lake 1 in Yaobokro (5.92947, −4.82629), followed by the second at the lake in Blékankro (5.91547, −4.82629). The third collection took place at the Trossou dam (5.90547, −4.82629), while the fourth was at Diallokro Lake (5.91947, −4.82629). Lastly, the final sample was taken from the Morokro spring (5.89847, −4.82629). In Yamoussoukro, samples were collected at five distinct sampling stations, corresponding to artificial lakes located in the village of Toumokro. The sites corresponded to the following coordinates: site 1 (6.83580, −5.28975), site 2 (6.83470, −5.28975), site 3 (6.83070, –5.28975), site 4 (6.82770, −5.28975), and site 5 (6.83570, −5.28975).

Environmental Water Sampling

Samples were collected during two distinct periods, corresponding to seasonal characteristics: the dry season in March 2021 and the rainy season in September 2021. The sampling matrix consisted of aqueous samples; at each sampling site, five one-liter volumes of water were collected, following a scheme of three repetitions. The fifteen samples collected per site were then amalgamated into a single container to ensure their homogeneity. Subsequently, one liter of this homogeneous solution was preserved in coolers equipped with cold packs to ensure the integrity of the samples during their transport to the laboratory for analysis.

Molecular Analyses

Mycobacterial DNA was extracted using a QIAGEN kit following the manufacturer’s protocols. Two amplification reactions were subsequently conducted: a real-time PCR targeting the IS2404 sequence and a conventional PCR targeting MIRU1 and locus 6 (Table I). The amplification programs are detailed in Table II. For the IS2404 qPCR, 0.75 µL of specific primers and 1.25 µL of their corresponding probe at 10 µM were used in a final reaction mix of 20 µL. The mix included 1.5 µL of MgCl₂ (25 mM), 0.5 µL of dNTPs (10 µM), 0.25 µL of Rox 1/10, 0.2 µL of Taq DNA Polymerase (5 U/µL), and 5 µL of extracted DNA. Amplification took place in a Quantstudio 5 device (Table II). Amplification of MIRU-VNTR sequences was carried out with 1 µL of specific primers (Table I) and 3 µL of DNA samples mixed with 5 µL of colored 5x buffer, along with 5 µL of non-colored 5X buffer, 3 µL of MgCl2 (25 mM), 1 µL of dNTPs (10 µM), 0.3 µL of Taq DNA Polymerase (5 U/µL), resulting in a final volume of 50 µL. PCR products were separated on a 1.5% agarose gel containing Sybr Safe, then visualized under UV light using the Gel Doc E2 Imager system by BIO-RAD Laboratories® (U.S.A). DNA migration was carried out with 10 µL of PCR amplicon in each well of the gel at an electric field strength of 130 mV for 20 minutes.

Table I. Primers Used for the Amplification of Mycobacteria

Primers	Target	Sequences (5″-3″)	References
IS2404	IS2404 F	ATTGGTGCCGATCGAGTTG	Shinoda et al . (2016)
	IS2404 R	TCGCTTTGGCGCGTAAA
	IS2404- probe	6 FAM-CACCACGCAGCATTCTTGCCGT-TAMRA
MIRU1	MIRU1 F	GCTGGTTCATGCGTGGAAG	Ablordeyet al. (2005); Hiltyet al. (2006); Stragieret al. (2005)
	MIRU1 R	GCCCTCGGGAATGTGGTT
VNTR-6	locus 6 F	GACCGTCATGTCGTTCGATCCTAGT
	locus 6 R	GACATCGAAGAGGTGTGCCGTCT

Table II. Amplification Parameters for qPCR and Real-Time PCR

Target	Stage	Temperature (°C)	Duration (m)	Number of cycles
IS2404	Denaturation	50	2	1
	Hybridation	95	10	35
	Elongation	95	15 S
	Final elongation	60	1	1
MIRU1VNTR-6	Initial denaturation	95	2	1
	Denaturation	94	1	35
	Hybridation	58	1
	Elongation	72	2
	Final elongation	72	10	1

Results

Detection of IS2404 Target of Mycobacteria

After performing DNA extraction, we proceeded with their analysis using real-time PCR. The objective of this procedure was to target the IS2404 insertion sequences, which are present in 200 copies within the genome of M. ulcerans—the examined samples (Fig. 1). In summary, the use of real-time PCR allowed us to detect the presence of the IS2404 insertion at multiple locations: site 5 in Abidjan, site 1 in Daloa, site 5 in Tiassalé, as well as sites 4 and 5 in Yamoussoukro. It is important to note that these five positive samples were collected during the dry season. However, during the rainy season, eight sites showed the IS2404 sequence in the samples. These sites include sites 4 and 5 in Abidjan; sites 2 and 4 in Daloa. Sites 2, 3, 4, and 5 in Tiassalé (Fig. 2).

Fig. 1. Amplification of IS2404 target using qPCR in samples of different sites.

Fig. 2. Distribution of IS2404 target in different sites.

Detection of MIRU-1 Targets of Mycobacteria

Molecular typing by MIRU-VNTR was performed to investigate different genetic profiles. We initially analyzed the VNTRs, which are short tandem repeat DNA sequences in the genome of organisms. Specifically, we examined VNTR locus 6. However, after the analysis, none of the samples showed the targeted VNTR sequences.

Subsequently, the analysis continued with locus MIRU 1. The objective was to count the number of tandem sequence repeats at this location for each sample studied. The genetic profiles obtained revealed two variations: one profile with 2 copies of the sequence and another with 3 copies (Fig. 3).

Fig. 3. Electrophoresis on a 1.5% agarose gel of MIRU 1 detection in different sites. M: Smart Ladder 100 bp molecular weight marker; NC: Negative control; PC: Positive control; 1: Abidjan Site 2 Dry Season; 2: Abidjan Site 3 Dry Season; 3: Daloa Site 1 Dry Season; 4: Daloa Site 2 Dry Season; 5: Tiassalé Site 1 Dry Season; 6: Abidjan Site 4 Dry Season; 7: Tiassalé Site 1 Rainy Season; 8: Daloa Site 3 Dry Season; 9: Tiassale Site 2 Rainy Season; 10: Yamoussoukro Site 1 Rainy Season; 11: Tiassalé Site 3 Rainy Season; 12: Tiassalé Site 4 Rainy Season; 13: Yamoussoukro Site 4 Rainy Season.

It is important to note that the variation in the number of repeats (2 copies or 3 copies) can be used to characterize and compare different mycobacterial strains. In this case, both MIRU 1 profiles had a size of 340 bp, while the three copies had a size of 486 bp.

During the dry season, the detection of MIRU 1 in the samples yielded significant results. Sites 2, 3, and 4 in Abidjan showed the presence of one copy of the MIRU 1 gene. Similarly, site 3 in Daloa exhibited two copies of the MIRU 1 gene. Site 5 in Tiassalé showed a detection of MIRU 1 with two copies. In the same vein, site 5 in Yamoussoukro also displayed two copies of the MIRU 1 gene.

During the rainy season, the results of MIRU 1 detection were also significant. Site 2 in Daloa presented two copies of the MIRU 1 gene. In Tiassalé, site 1 showed three copies of the gene, while sites 3 and 4 had two copies. Site 5 in Yamoussoukro also exhibited two copies of MIRU 1. These repeated results demonstrate the presence and variation of MIRU 1 in different sampling sites, both during the dry season and the rainy season (Fig. 4).

Fig. 4. Distribution of MIRU-1 target in different sample sites.

Discussion

The real-time PCR analysis aimed at detecting IS2404 insertion sequences in M. ulcerans has yielded significant results, providing crucial information regarding the presence of this bacterium in the studied aquatic ecosystems within each endemic city. The prevalence of the IS2404 sequence in the samples observed both during the dry and rainy seasons highlights the ubiquity of Mycobacterium in the examined sites. Notable sites where the sequence was found include station 5 in Abidjan, station 1 in Daloa, station 5 in Tiassalé, as well as stations 4 and 5 in Yamoussoukro. These observations reinforce the notion of a constant presence of the bacterium in these regions.

These results shed light on a possible correlation between M. ulcerans and aquatic environments. The omnipresence of the IS2404 sequence in the sampled sites suggests complex interactions between M. ulcerans and its environment, while raising questions about the biotic and abiotic reservoirs of this bacterium. These findings support the idea that Mycobacterium can survive and proliferate in various types of environments, especially in aquatic settings (Singhet al., 2019). The presence of Mycobacterium ulcerans in water samples from all cities could also result from environmental transmission of Buruli ulcer through various vectors and reservoirs. Although previous consensus leaned towards contact with contaminated soil or ulcerated wounds as the primary mode of transmission, the research Konanet al. (2019) examined social and environmental risk factors that may expose populations to mycobacterial infections. After analyzing the dynamics of local knowledge transfer and practices related to Buruli ulcer in two endemic localities in Côte d’Ivoire, namely Taabo and Daloa, it was found that the etiology of the disease was linked to natural causes such as water and insects.

The presence of the IS2404 sequence in samples from all sampled cities reveals the ubiquity of the bacterium, which results from its adaptation to specific conditions. When environmental conditions become unfavorable, especially in terms of resources and growth factors, M. ulcerans responds by altering its cellular processes. This adaptive response aims to enable its survival in hostile conditions, explaining its presence in most of the sampled waters. Studies by Ayerakwaet al. (2023) have shown that one survival strategy adopted by M. ulcerans in response to unfavorable conditions is the production of endospores. Research led by Halstromet al. (2015) established that the genetic presence of mycobacterial species, including Mycobacterium ulcerans, in aquatic and humid environments could result from their ability to form biofilms (Steed & Falkinham, 2006). This conclusion is supported by the research conducted by Mullis and Falkinham (2013), which focused on the adhesion and biofilm formation of mycobacteria. Their work revealed that M. avium, M. intracellular, and M. abscessus adhered to and created biofilms on various materials, suggesting this is a survival mechanism in moist environments (Pereiraet al., 2020). Furthermore, the mobility associated with this sequence over time could have significant implications for the diversity and distribution of mycobacteria within aquatic and humid ecosystems.

Thus, the conclusions drawn from the study by Ngazoa Kakouet al. (2015) suggest that the recurrence of the IS2404 sequence in clinical samples may result from the continuous spread of these genetic sequences in the environment. Moreover, the results obtained in this study demonstrated that all clinical samples taken from Buruli ulcer patients reacted positively to molecular tests targeting IS2404. The main objective of this research was to conduct an analysis of molecular diversity using the MIRU/VNTR method on clinical samples from patients affected by this disease in Côte d’Ivoire. In addition to this study, the work Tchanet al. (2023) also identified the IS2404 sequence in samples from various endemic areas. Taking into account the research conducted by Ngazoa-Kakouet al. (2019), it is increasingly plausible to consider that the frequent recurrence of the IS2404 sequence in samples may reflect a continuous dissemination of genetic strains in the environment. This highlights the potential impact of this ongoing dissemination on the diversity and distribution of mycobacteria within aquatic and humid ecosystems, possibly promoting their adaptation and evolution.

The absence of detection of VNTR sequences, particularly at locus 6, in the analyzed samples raises questions. This absence may be related to specific characteristics of Mycobacterium in these cities, indicating genetic differences among bacterial populations. Additionally, numerous studies in the literature have reported that mycobacteria in their environments may influence the detection of VNTR sequences, especially locus 6, in environmental samples (Dassi, 2016; Djouakaet al., 2018; Gyamfiet al., 2022; Lavenderet al., 2008; Ngazoa Kakouet al., 2015; Vakou, 2017; Zeukenget al., 2021). It is also important to emphasize that changes in microbial composition, nutrient availability, or climatic conditions could contribute to fluctuations in the distribution of VNTR sequences.

The absence of locus 6 in the samples could also be explained by a specific mutation or deletion. Bacterial strains, including Mycobacterium, can undergo genetic alterations over time. In the context of our study, these alterations could potentially lead to a modification of the locus 6 sequence. This situation could result in a different reference sequence being used for identification. Mutations can occur spontaneously due to the accumulation of random genetic changes, but they can also be induced by factors such as exposure to environmental mutagens.

It is also possible to speculate that the absence of locus 6 could stem from the adaptability of mycobacteria to their environment. Jackson (2014) had already highlighted that Mycobacterium ulcerans had developed several resistance mechanisms to persist in hostile environmental conditions. This adaptability even includes the production of photoprotective compounds aimed at enhancing its survival (Robledoet al., 2011). Furthermore, deletions, which correspond to the loss of a portion of genetic material, could also occur in locus 6. If the key region of locus 6 has been deleted, it could prevent its detection by the methods used. Mutations and deletions can be influenced by adaptation to environmental changes. In the environment, deletions and insertions exist, affecting bacteria such as M. ulcerans and M. marinum, which share 98% of their genome and similar genetic markers. However, genomic similarities hide distinct molecular characteristics resulting from various insertions and deletions. These genetic variations demonstrate the bacteria’s ability to adapt and evolve, reflecting changes in their genome and ecology (Stinearet al., 2000).

Inter-strain genetic variability should also be considered to explain the observed absence of locus 6. Mycobacterium strains are extremely diverse, even within the same species. This variability can result from the accumulation of mutations, genetic recombination, and other evolutionary processes. Therefore, it is possible that the locus 6 strain in the sample naturally differs from the reference sequence used for identification.

The study of the MIRU 1 locus offers important insights into the genetic adaptation of mycobacteria to seasonal variations in aquatic environments. In this context, we have analyzed the genetic profiles of Mycobacterium in detail, with a focus on the MIRU 1 locus, during two distinct seasonal periods: the dry season and the rainy season. Our results highlight significant differences in the number of copies of the MIRU 1 tandem sequence between these two seasons. This observation raises questions about the underlying mechanisms behind these variations.

Conclusion

This study provides an in-depth analysis of the genetic adaptation mechanisms and responses of mycobacteria to seasonal variations in aquatic environments. It underscores the importance of considering not only the interactions between bacteria and their environment but also the underlying genetic mechanisms that influence their survival and spread. These findings have significant implications for our understanding of mycobacterial adaptation mechanisms and for the management of their impact on public health and aquatic ecosystems.